Sarafem

Figure 5. Effect of arsenic trioxide As2O3 ; on IHERG. Example of IHERG recorded in the absence Control ; and presence of As2O3 100 M ; . In this experiment, IHERG was recorded within 5 mins of drug application, but similar results were found in other experiments when the length of As2O3 100 M ; exposure was increased to 20-30 mins not shown ; . In contrast, addition of 1 M terfenadine to the same cells rapidly abolished IHERG. N 4 ; were exposed to control MO or PEG mixtures and complete MO or PEG mixtures, and perfusate samples were collected hourly to determine IL-8 release. The only significant mixture effects were SRA + MO + LAS + TRI + TEA causing an increase in IL-8 release. Exposure to TRI alone appeared to increase erythema, edema, and dermal inflammation compared to the other additives, while SRA alone was least likely to initiate a dermal inflammatory response. In 2-component mixture exposures, the presence of TRI appeared to increase the dermal inflammatory response at 4 and 8 hrs especially with the PEG mixtures. In the 3- and 4-component mixtures, MO mixtures are more likely to incite an inflammatory response than PEG mixtures. In summary, these preliminary studies suggest that the biocide, TRI, is the more potent of the 4 performance additives in causing dermal irritation, and this may vary depending on whether the worker is exposed to a synthetic- or MO-based fluid. Supported by NIOSH Grant R01-OH-03669 ; INVESTIGATION OF THE SENSITIZATION POTENTIAL OF FRAGRANCE INGREDIENT 3 AND 4- 4-HYDROXY4-METHYLPENTYL ; -3-CYCLOHEXENE-1CARBOXALDEHYDE HMPCC ; . A. Api, J. Cocchiara and C. Letizia. Research Institute for Fragrance Materials, Inc., Woodcliff Lake, NJ. 3 and 4- 4-Hydroxy-4-methylpentyl ; -3-cyclohexene-1-carboxaldehyde HMPCC, CAS Nos. 31906-04-4 and 51414-25-6 ; is a fragrance ingredient with a sweet, light and floral odor used in all types of cosmetic and household products. Three guinea pig studies a modified Draize and two Magnusson and Kligman maximization tests ; and a murine local lymph node assay indicate that the material has a weak potential to induce skin sensitization. The results from human predictive tests numerous repeated insult patch tests and one human maximization test ; conducted at various concentrations, also predict that the material is a weak skin sensitizer. The diagnostic patch test data indicate that the material is a moderate to strong skin sensitizer. The skin sensitization potential of this material is summarized and a dermal sensitization risk assessment is presented. ASSESSMENT OF SKIN ABSORPTION AND METABOLISM OF ARACHIDONIC ACID & GLYCERYL ARACHIDONATE USING IN VITRO DIFFUSION CELL TECHNIQUES. A. R. Eppler1, 2, M. E. Kraeling1, R. R. Wickett2 and R. L. Bronaugh1. 1Office of Cosmetics and Colors Cosmetic Toxicology Branch, US Food & Drug Administration, Laurel, MD and 2College of Pharmacy, University of Cincinnati, Cincinnati, OH. Arachidonic acid AA ; , has been used in cosmetics as a surfactant-cleansing and emulsifying agent. Glyceryl arachidonate GA ; , a skin conditioning agent and emollient, may be partially metabolized by ester hydrolysis in skin to AA. Based on the Cosmetic Ingredient Review CIR ; Panel's concern that there was a lack of dermal absorption data for AA, in vitro percutaneous absorption and metabolism studies were initiated. To simulate normal consumer use, AA and GA were applied in an oil in water emulsion 2mg cm2 ; to skin samples 200um thick in flow-through diffusion cells perfused with a physiological buffer. To assay for permeation, viable fuzzy rat and human skin were dosed with [14C]AA containing ~0.5uCi 0.01mg ; AA cell while [3H]GA was applied to viable and cadaver human skin at ~0.5uCi 0.003mg ; GA cell. For metabolism analysis, the skin equivalent Epiderm was dosed with [3H]GA under similar conditions. Receptor fluid fractions were collected at 6h intervals over a 24h dosing period. Skin penetration was determined by liquid scintillation counting and expressed as a percent of the applied dose. High performance liquid chromatography was used to assess metabolism to AA. Absorption of AA through rat skin was 19.8 5.3 % mean SEM ; compared to only 1.4 0.3 % through human skin. Total AA penetration receptor fluid plus skin levels ; in rat and human skin was 52.3 7.3 and 20.1 5.4 %, respectively. Total GA penetration of viable skin was found to be 11.3 2.1% with only 3.2 0.5% absorbed through the skin. In cadaver skin, 4.8 0.8% GA was absorbed through skin with a total penetration of 6.7 1.2%. Assay of the Epiderm receptor fluid found ~50% absorption of radioactivity and 3.0 2.1% GA conversion to AA. In conclusion, percutaneous absorption of AA was less through human than rat skin, while GA absorbed through Epiderm was metabolized to AA. MIXTURE EFFECTS OF JET FUEL ALIPHATIC AND AROMATIC HYDROCARBONS ON HUMAN EPIDERMAL KERATINOCYTES. C. Chou1, J. Yang2, C. Lee1 and N. A. Monteiro-Riviere3. 1Veterinary Medicine, National Chung-Hsing University, Taichung, Taiwan, 2Chung-Shan Medical University, Taichung, Taiwan and 3Center for Cutaneous Toxicology and Research Pharmacokinetics, NC State University, Raleigh, NC. Jet fuels are complex mixtures of aliphatic ALI ; and aromatic ARO ; hydrocarbons that vary significantly in individual cytotoxicity and proinflammatory activities in human epidermal keratinocytes HEK ; . In order to elucidate the dermatotoxicity.

Large amounts of water are lost when vomiting and with diarrhea, especially if the patient does not drink adequate amounts of fluid to replace the depleted water.
Thirty-three medicines were advertised on US TV between late 1997, when the US FDA relaxed its regulations and made it easier for companies to advertise on TV, and the end of 1998. The ads for seventeen of these 33 drugs -- more than 50% -- were found to violate FDA regulations, most commonly by downplaying risks. Some ads also exaggerated benefits and implied that the products could be used to treat a wider range of conditions than the government approved them for. Pravachol: Bristol-Myers Squibb used women athletes in advertisements promoting the use of its drug Pravachol, which is approved for lowering cholesterol, to reduce the risk of heart attacks. The FDA judged this to be misleading because Pravachol has never been shown to protect women against heart attacks. Sarafem: The FDA judged that a television ad for Sarafek fluoxetine ; showing a woman angrily pushing a shopping cart in a crowded supermarket was illegal because it hinted that any woman with pre-menstrual mood swings could benefit by using this antidepressant. Sarfaem is the same product as Prozac sold under a different name. It has been approved for use for pre-menstrual dysphoric disorder, a more serious mood disorder, not for pre-menstrual syndrome. Premarin: The FDA objected to ads for Premarin, a hormone treatment for menopause, because Wyeth-Ayerst claimed vague, unspecified health benefits when there is no good evidence of any benefit from that drug other than reducing menopausal symptoms. For sugar syrup: cup sugar 1 cup water 2 teaspoons freshly squeezed lemon juice Allow the potatoes to cool slightly. Place them in a bowl with the eggs, cheese, matzo meal, salt, and pepper. Stir the ingredients until smooth. In a large, deep saut pan, heat inch of olive oil till hot but not smoking. Drop two tablespoons of batter at a time into the hot oil, and fry on all sides until golden brown. Place on a baking sheet lined with brown paper. While still hot, drizzle bunuelos with the sugar syrup recipe follows ; , honey, or cinnamon-sugar. Serve at once. Place the sugar, water, and lemon juice in a saucepan and bring to a boil. Stir to dissolve the sugar. Turn the heat to low and simmer for 15 minutes. Serves 6. Source: "Latke recipes to make sure your Hanukkah spuds aren't duds" Julie Riven The Boston Globe on-line edition ; , 12 09 98. Is the lilly statement that sarafem will remain patent protected by a method of use patent that legally prohibits generic substitution accurate or correct and sinequan.

In cell phones & plans - asked by monsieur london - 4 answers - 3 weeks ago - resolved more 60 ; contacts fans view by: date added a-z invite friends • hollister boy • … member since: 10 july 2008 total points: 265 level 2 ; points earned this week: -% best answer hollister boy site c%3d1mkjl2wp2e6fd5g2kpfg6jm. Add a comment answer 6 out of 6 by someguy - is taking a vacation soon 74 on jul 4, 2008 at 7: 27 permalink go to your doctor and get the behind your ear nausea patches they give chemotherapy patients and pamelor. Medications Affected by This Policy Members who have previously progressed to a Step 2 or a Step 3 medication without clinical response will not be required to undergo a trial of a Step 1 medication to be covered for a Step 2 or a Step 3 alternative. Step 1 medications The following will be covered without prior authorization: I bupropion HCl I bupropion SR I bupropion XL 300mg I fluvoxamine I fluoxetine HCl I paroxetine HCl I sertraline I venlafaxine I citalopram HBr Step 2 medications The following will require prior use of a Step 1, 2, or 3 medication for coverage: I Effexor XR I Lexapro I Paxil CR I Wellbutrin XL 150 mg I Cymbalta Step 3 medications The following will require prior use of a Step 2 or 3 drug for coverage: I Celexa I Effexor I Luvox I Paxil I Pexeva I Prozac I Prozac Weekly I Rapiflux I Darafem I Wellbutrin SR I Wellbutrin XL 300 mg I Wellbutrin I Zoloft!

Commodity Chamois leather, including combination chamois . Chamois, cotton, napped, dyed, weighing over 200 g m2 5.90 oz syd ; Chamomile flowers. Chamomile oil . Chamotte earth . Champagne . Chandeliers, base metal, except antique Chandeliers, glass, except antique . Change purses, leather. Changepurses, precious metal. Channels, aluminum, fabricated . Channels, curtain and drapery, base metal . Channels, iron or steel, fabricated . Channels, zinc, fabricated . Chantilly lace, cotton, machine made, ornamented . Chantilly lace, nylon, ornamented. Chaplets, hinge, of base metal . Char, activated . Charcoal crayons including fusains ; . Charcoal, activated . Charcoal, animal, blocks. Charcoal, wood including shell and nut charcoal ; whether or not agglomerated Chard, fresh or chilled . Charger sets, battery, rotating type . Chargers, battery rectifier ; . Charges for fire extinguishers . Charges, gun casing . Charges, shaped. Charges, squeeze . Charges, tubing-gun. Charts, geographical, hand-drawn originals, carbon copies thereof or reproductions on sensitized paper. Charts, geographical, printed . Charts, hydrographic, hand-drawn originals, carbon copies thereof or reproductions on sensitized paper. Charts, hydrographic, printed. Charts, meteorological, hand-drawn originals, carbon copies thereof or reproductions on sensitized paper. Charts, meteorological, printed . Charts, navigational, hand-drawn originals, carbon copies thereof or reproductions on sensitized paper. Charts, navigational, printed . Charts, printed, n.e.s.o.i Chasers, interchangeable, for machine or handtools . Chassis for truck mounted cranes . Chassis, motor bus. Chassis, passenger automobile . Chassis, radio. Chassis, television and glucophage. IL-8 3k-UTR has nine AUUUA pentamers which have been suggested to destabilize IL-8 mRNA.9 There are ve AUUUA elements in fragment e, four of them between nt 25522577 within a unique AU-rich sequence, UAUUUAUUAUUUAUGUAUUUAUUUAA, and one between nt 26532657. This AU-rich sequence also contains two UAUUUAUU and one UUAUUUAU octamers. AU-rich elements, especially AUUUA, have been well documented to accelerate the degradation of mRNA of many genes, including cytokines, growth factors, and proto-oncogenes.24, 25, 31 However, in the mouse broblast cell line NIH 3T3, a UUAUUUA U A ; U nonamer was suggested to be the minimum functional sequence leading to the destabilization of the mRNA, whereas AUUUA alone is not sufcient to cause the degradation of mRNA. Several derivatives from the UUAUUUA U A ; U nonamer, UUAUUUAU and UAUUUAUU octamers, are capable of destabilizing mRNA but have reduced potency.22, 23 In this study, we demonstrated that the AU-rich sequence in IL-8 3k-UTR was not a major contributor to the degradation of IL-8 mRNA since addition of the AU-rich sequence UAUUUAUUAUUUAUGUAUUUAUUUAA nt 25522577 ; into the CAT reporter gene caused a weak reduction in CAT activity. Recently, Winzen et al.32 demonstrated that AU-rich sequences within this region had no destabilizing effect. However, our study clearly revealed that deletion of AU-rich sequences from e attenuated the inhibitory effect of e on reporter gene expression. Therefore, this unique AU-rich sequence in the IL-8 3k-UTR may be crucial for maximum CAT mRNA turnover. It is possible that the effect of these AU-rich elements in the IL-8 3k-UTR may need additional cis-element s ; or proper secondary structure. In serum-stimulated NIH-3T3 cells treated with transcription inhibitors the degradation of a-globin mRNA mediated by c-fos 3k-UTR was blocked but had no effect on native c-fos mRNA decay.33 Other studies34 have showed that urokinase mRNA was stabilized in the presence of a transcriptional inhibitor in mouse bone-marrow-derived macrophages whereas signicant decay of the mRNA transcripts occurred within 1 hr in the absence of the transcription inhibitor. In a pig kidney epithelial cell line LLC-PK1, urokinase mRNA had a half-life of 70 min following treatment with a transcription inhibitor.35 Our ndings demonstrate that IL-8 3k-UTR can destabilize CAT mRNA in COS 7 cells only during active transcription. In contrast, the decay of native IL-8 mRNA in T84 human colonic epithelial cells occurred in the presence of a transcription inhibitor.18 It is likely that the effects of IL-8 3k-UTR on degradation of native IL-8 mRNA or chimeric reporter gene mRNA are different or vary in different cell types.3335 Taken together, this study clearly demonstrates a potential role for fragment e in IL-8 mRNA degradation, which is in agreement with previous studies.32 In summary, our studies demonstrate the down-regulatory function of IL-8 3k-UTR. A distinct 357-base fragment e ; between nt 23873743 was shown to be important in chimeric reporter gene mRNA turnover. The decay of the mRNA transcripts mediated by IL-8 3k-UTR required active transcription in COS 7 cells. Mutational analysis of the fragment revealed that AU-rich sequences do not play a major role but are essential for maximum degradation of CAT mRNA. This study gives new insights in unravelling the molecular.
Table of Contents PRO 2000. In June 2000, we licensed exclusive, worldwide rights from Paligent, Inc. formerly HeavenlyDoor and Procept, Inc. ; "Paligent" ; to develop and market PRO 2000, in exchange for an up-front payment, future milestone payments, and royalties on net sales. We are responsible for all remaining development and commercialization activities for PRO 2000. In April 2003, we amended the terms of the PRO 2000 licensing agreement. Paligent agreed to relinquish a potential future 0, 000 milestone payment and provide us with an option to acquire all rights to PRO 2000 by a certain future date in exchange for an immediate 0, 000 payment and an optional buyout payment by us. Aminocandin. We licensed exclusive, worldwide rights to aminocandin from Aventis in April 2003. In exchange for these rights and for Aventis' inventory of aminocandin, we made an up-front payment to Aventis and are obligated to pay potential milestones and royalties on future sales. Under the Aventis agreement, we are responsible for all development and commercialization activities for both intravenous and oral formulations of aminocandin. Aventis has agreed to manufacture the key component of aminocandin, using its proprietary fermentation technology. Sarafem. In June 1997, we entered into an agreement with Lilly, under which we sublicensed to Lilly exclusive, worldwide rights under an MIT patent that was licensed exclusively by MIT to us and which is directed to the use of fluoxetine to treat certain conditions and symptoms associated with PMS. In July 2000, Lilly received approval for fluoxetine to treat a severe form of PMS and is marketing the drug under the trade name Sarafem. Lilly's composition of matter patent on fluoxetine expired in July 2001. The Lilly agreement provided for milestone payments and royalties based on net sales of fluoxetine attributable to the approved indication in the United States up to an annual maximum limit. In December 2002, we entered into a renegotiated licensing agreement with Lilly providing us an initial payment upon the signing of the agreement and future royalty payments from Lilly based on net sales of Sarafem in the United States from October 1, 2002 until the expiration of our patent related to Sarafem. In addition, the agreement includes other potential milestone payments to us from Lilly. In January 2003, Galen Holdings PLC announced the completion of the acquisition of the sales and marketing rights to Sarafem from Lilly. Pursuant to our agreement with Lilly, the remaining milestone payments were accelerated and received by us from Lilly. MANUFACTURING AND MARKETING General. Our ability to conduct clinical trials on a timely basis, to obtain regulatory approvals and to commercialize our products will depend in part upon our ability to manufacture our products, either directly or through third parties, at a competitive cost and in accordance with applicable FDA and other regulatory requirements, including cGMP regulations. We have no manufacturing facilities and limited marketing capabilities. In general, we intend to seek corporate collaborations in which a third party assumes responsibility and funding for manufacturing and marketing products. To the extent we enter into collaborative arrangements with pharmaceutical and other companies for the manufacturing or marketing of products, these collaborators are generally expected to be responsible for funding or reimbursing us all or a portion of the development costs, including the costs of clinical testing necessary to obtain regulatory clearances, and for commercial-scale manufacturing and marketing. These collaborators are expected to be granted exclusive or semi-exclusive rights to sell specific products in exchange for license fees, milestone payments, royalties, equity investments or other financial consideration. Accordingly, we will be dependent on such third parties for the manufacturing and marketing of products subject to the collaboration. There can be no assurance we will be able to obtain or retain third-party manufacturing and marketing collaborations on acceptable terms, or at all, which may delay or prevent the commercialization of products under development. Such collaborative arrangements could result in lower revenues and profit margins than if we marketed a product ourself. In the event we determine to establish our own manufacturing or marketing capabilities, we would require substantial additional funds. 14 and actoplus and Order sarafem.

Why are these doctors not educated in a subject that consumes 15 years of a woman's life. The modulation of intracellular C a 2 may be generally relevant to phase shifting and clock mechanisms. For instance, in bulla, phase shifts of the circadian clock in the ocular circadian pacemaker are blocked by C a channel antagonists Khalsa and Block, 1988 ; . Similarly, C a 2 can modulate the circadian variation of melatonin secretion in chick pineal cells Nikaido and Takahashi, 1996 ; . In previous work on the rat SCN in vitro, intracellular C a 2 was found to play a crucial role in the maintenance of circadian rhythms of 2-deoxyglucose utilization Shibata et al., 1987 ; . The participation of GABAB receptors in modulating C a 2 influx may allow GABA to modulate cytoplasmic C a 2 levels, thereby potentially influence clock timing. Previous studies have shown that GABAA and GABAB receptors may both play important roles in the phase-shifting actions of and actos. Class Sub-class Brand Names CATAPRES TENEX Anticonvulsants CARBATROL, EPITOL, TEGRETOL DEPAKOTE, DEPAKENE Mood Stabilizers LAMICTAL NEURONTIN TOPAMAX TRILEPTAL Antidepressants ANAFRANIL ASENDIN PAMELOR ELAVIL Tricyclic TCA ; LIMBITROL NORPRAMIN SINEQUAN, ZONALON SURMONTIL TOFRANIL CELEXA EFFEXOR Selective Serotonin Uptake Inhibitors SSRI ; LEXAPRO LUVOX PAXIL PROZAC, SARAFEM PULVULES ZOLOFT DESYREL Other Antidepressants REMERON SERZONE BUDEPRION, WELLBUTRIN, ZYBAN Chemical Names Clonidine Guanfacine Carbamazepine Valproic Acid Divalproex sodium Lamotrigine Gabapentin Topiramate Oxcarbazepine Clomipramine Amoxapine Nortriptyline Amitriptyline Amitriptyline Chlordiazepoxide CDP ; Desipramine Doxepin Trimipramine Imipramine Citalopram Venlafaxine Escitalopram Fluvoxamine Paroxetine Fluoxetine Sertraline Trazodone Mirtazapine Nefazodone Bupropion Comptroller Summary Labels Other ADHD Drugs Other ADHD Drugs Mood Stabilizers Mood Stabilizers Mood Stabilizers Mood Stabilizers Mood Stabilizers Mood Stabilizers Antidepressants Antidepressants Antidepressants Antidepressants Antidepressants Antidepressants Antidepressants Antidepressants Antidepressants Antidepressants Antidepressants Antidepressants Antidepressants Antidepressants Antidepressants Antidepressants Antidepressants Antidepressants Antidepressants Antidepressants Medicaid was not billed for the medications in blue for Texas foster children in fiscal 2004. Alpha Agonists. Rr vibrant, passionate, and involved, susun weed has garnered an international reputation for her groundbreaking lectures, teachings, and writings on health and nutrition. NCEP ATP III gives guidance for younger adults men 20-35 & women 20-45 ; It recognizes that; "even though clinical CHD is relatively rare in young adults, coronary atherosclerosis may progress rapidly . and elevated cholesterol in young adulthood predicts a higher rate of premature CHD in middle age." Says that young men who smoke or who have LDL 160 may be candidates for lipid lowering drugs. Equiptment should be kept in the room since it does have the potential to come into contact with fluids or other items that came into contact with fluids. Abnormal fat distribution and abnormalities in blood lipids, blood glucose and lactate are common in patients with HIV when treated with highly active antiretroviral therapy HAART ; [1]. These changes in body shape and metabolic abnormalities are collectively known as lipodystrophy, although it is not clear whether this is a single syndrome or several [2, 3] and buy sinequan. In an intermittent– dosing placebo– controlled trial, no events associated with discontinuation reached an incidence of 2% for sarafem 20 mg.

Sarafem tablets This is a reminder to pharmacists regarding the legal generic substitution of certain drug products. Recent practices by pharmaceutical manufacturers involving the marketing of one drug product under more than one brand name and indication seem to have caused some confusion. Examples of such practices include the marketing of Prozac and SarafemTM fluoxetine HCl ; by Eli Lilly and Company, Proscar and Propecia finasteride ; by Merck, and Wellbutrin and Zyban bupropion ; by GlaxoSmithKline. The fact is that patent exclusivity for one product will generally expire prior to that of the other product; therefore, a generic product will likely become available for the product to first expire, but not for the other. The reason for this is that US patent laws allow the issuance of patents, not only for new molecular entities, but also for new, nonobvious uses of old molecular entities. In the Prozac Sarafem example, the patent for Prozac, which is indicated for depression, obsessive complusive disorder, and bulimia, expired in August 2001, opening the door for generic competition and opportunities for generic substitution. The patent for Sarafem, which is indicated only for premenstrual dysphoric disorder PMDD ; , remains in effect through the year 2007. In line with these occurrances, the FDA "Orange Book" Approved Drug Products with Therapeutic Equivalence Evaluations ; now lists the fluoxetine preparations considered equivalent to Prozac those that are "A" rated ; , but continues to list Sarafem as having no therapeutic equivalent. This means that in those states where generic substitution is allowed for Orange Book A-rated products, pharmacists may substitute such a generic product for Prozac, but not for Sarafem. Situations like this are likely to become more common as an increasing number of pharmaceutical manufacturers market products in this manner. This ad is for sarafem fluoxetine ; , the same drug as prozac, marketed under a different name for premenstrual dysphoric disorder. Note 8. Shareholders' Equity Common stock and capital surplus Japanese companies are subject to the Japanese Commercial Code the "Code" ; . The Code requires that all shares of common stock are recorded with no par value and at least 50% of the issue price of new shares is required to be recorded as common stock and the remaining net proceeds as additional paid-in capital, which is included in capital surplus. The Code permits Japanese companies, upon approval of the Board of Directors, to issue shares to existing shareholders without consideration as a stock split. Such issuance of shares generally does not give rise to changes within the shareholders' accounts. The Code also provides that an amount at least equal to 10% of the aggregate amount of cash dividends and certain other appropriations of retained earnings associated with cash outlays applicable to each period shall be appropriated as a legal reserve a component of retained earnings ; until such reserve and additional paid-in capital equals 25% of common stock. The amount of total additional paid-in capital and the legal reserve that exceeds 25% of common stock may be available for dividends by resolution of the shareholders. In addition, the Code permits the transfer of a portion of additional paid-in capital and the legal reserve to common stock by resolution of the Board of Directors. The Code allows Japanese companies to repurchase treasury stock and dispose of such treasury stock by resolution of the Board of Directors. The repurchased amount of treasury stock cannot exceed the amount available for future dividends plus the amount of common stock, additional paid-in capital or the legal reserve to be reduced in the case where such reduction was resolved at the shareholders' meeting.

Sarafem drug interactions Sarafem without prescription Zarafem, sarfaem, sarwfem, asrafem, sarafrm, warafem, sarrafem, saarfem, swrafem, arafem, saracem, sxrafem, saeafem, safafem, saraafem, darafem, sarsfem, sarafme, saraefm, sa5afem, sqrafem, sarafe, saradem, sarafej, saraf4m, sarzfem, earafem, sarafek, saraem.

© 2007